after dna replication is completed, _____.

after dna replication is completed, _____.


S
Asked by 2 years ago
9.9k points
This is an image of a _____.phage
Who demonstrated that DNA is the genetic material of the T2 phage?Hershey and Chase
The radioactive isotope 32P labels the T2 phage's _____.DNA
Hershey and Chase used _____ to radioactively label the T2 phage's proteins.35S
After allowing phages grown with bacteria in a medium that contained 32P and 35S, Hershey and Chase used a centrifuge to separate the phage ghosts from the infected cell. They then examined the infected cells and found that they contained _____, which demonstrated that _____ is the phage's genetic material.labeled DNA ... DNA
Video Tutor Session Quiz: DNA StructurePart A: Blue Part B: Phosphate Part C: CGTG Part D: 4 Part E: Sugar and phosphate only
Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins?sulfur
Which of the following is found in RNA but not in DNA?an additional hydroxyl group
On one strand of DNA, one nucleotide is linked to the next through _____.covalent bonds between the sugar of one nucleotide and the phosphate of the next
What amount of thymine would be found in a double stranded of DNA composed of 15% cytosine?35%
Learning through Art: DNA Structurea. double helix b. phosphate group c. deoxyribose d. hydrogen bond e. base pair f. nucleotide g. nitrogenous base
In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.thymine ... cytosine
If you measure the amounts of the bases in any sample of DNA, you'll find that ...the amount of A + the amount of G = the amount of T + the amount of C.
Which statement expresses a real difference between DNA and RNA?(b) DNA is much longer than RNA.
What holds the strands of the DNA double helix together?Hydrogen bonds between purines and pyrimidines.
If you were to analyze a DNA sample from a eukaryotic cell, you would find that:Both (a) and (c).
Which of the following is true about double-stranded DNA?Its width is about 2 nm.
BioFlix Activity: DNA Replication -- Nucleotide PairingLeft Side, Top to Bottom: T, G Right Side, Top to Bottom: A, C
Which of the following build(s) new strands of DNA?DNA polymerases
Which statement about DNA replication is CORRECT?The leading strand is built continuously, and the lagging strand is built in pieces.
During DNA replication, which nucleotide will bind to an A nucleotide in the parental DNA?T
The molecule that seals the gaps between the pieces of DNA in the lagging strand isDNA ligase.
Which statement about DNA replication is FALSE?DNA ligase adds nucleotides to the lagging strand.
During replication, the original "parent" DNA _____.serves as the template for the creation of two complete sets of DNA
In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.thymine ... cytosine
After DNA replication is completed, _____.each new DNA double helix consists of one old DNA strand and one new DNA strand
The first step in the replication of DNA is catalyzed by _____.helicase
The action of helicase creates _____.replication forks and replication bubbles
Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?DNA polymerase can assemble DNA only in the 5' to 3' direction
The synthesis of a new strand begins with the synthesis of a(n) _____.RNA primer complementary to a preexisting DNA strand
An old DNA strand is used as a _____ for the assembly of a new DNA strand.template
Short segments of newly synthesized DNA are joined into a continuous strand by _____.ligase
After DNA replication is completed, _____.each new DNA double helix consists of one old DNA strand and one new DNA strand
The action of helicase creates _____.replication forks and replication bubbles
Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?DNA polymerase can assemble DNA only in the 5' to 3' direction
An old DNA strand is used as a _____ for the assembly of a new DNA strand.template
Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. Which of the following is the most probable reason for this observation?Prokaryotic DNA is much smaller than eukaryotic DNA.
Which of the following occurs during DNA replication?DNA polymerase elongates the daughter strand, adding new nucleotides to the 3' end of the molecule. The molecule grows 5' to 3' but is therefore read 3' to 5'.
BioFlix Activity: DNA Replication -- DNA Replication Diagrama. Parental DNA b. DNA polymerase c. Leading Strand d. Lagging strand e. DNA ligase f. Replication fork
BioFlix Activity: DNA Replication -- Lagging Strand Synthesis1. DNA polymerase begins synthesizing the lagging stand by adding nucleotides to a short segment of RNA 2. After each piece of lagging stand is complete, it is released from DNA polymerase 3. A different DNA polymerase replaces the RNA segments with DNA 4. DNA ligase seals the gaps between the pieces, and eventually forms a continuous stand.
Genes provide the information needed to produce _____ in the cell.enzymes
You have grown Neurospora under a variety of conditions listed below. You are trying to find a wild-type variety. Neurospora growing on which of these media could possibly be of the wild type?the wild-type Neurospora could grow in any of these conditions
How many enzymes are typically produced from a single gene?one
In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. Which choice is the best explanation for this observation?Translation cannot occur until the RNA leaves the nucleus in eukaryotes.
A new organism is discovered that has six different nucleotides that encode 30 different amino acids. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism?two-nucleotide sequence
Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)prematurely stops the translation of the protein
In the diagram below, the gray unit represents _____.RNA polymerase
In the diagram below, the green unit represents _____.the promoter
In the diagram below, the two blue strands represent _____.DNA
Which of these correctly illustrates the pairing of DNA and RNA nucleotides?GTTACG CAAUGC
The direction of synthesis of an RNA transcript is _____.5' > 3'
BioFlix Activity: Protein Synthesis -- TranscriptionLeft to Right: U, C, G, A
Which of the following events occurs during transcription?A molecule of RNA is formed based on the sequence of nucleotides in DNA.
Which of the following is a correct statement about mRNA?mRNA moves from the nucleus to the cytoplasm following RNA processing.
The site of translation isribosomes in the cell cytoplasm.
Which one of the following does not play a role in translation?DNA
Which of the following does not occur during RNA processing?mRNA attaches to the small subunit of a ribosome.
In transcription, _____.RNA polymerase links nucleotides to form mRNA.
In eukaryotic cells, a terminator in mRNA synthesis is _____.a specific nucleotide sequence in DNA that signals the RNA polymerase to stop
RNA processing involves the addition of ________ to the ends of the RNA transcript.extra nucleotides
The RNA segments spliced to one another during RNA processing are _____.exons
Translation occurs in the _____.cytoplasm
BioFlix Activity: Protein Synthesis -- RNA Processing1. A modified guanine nucleotide is added to the beginning of the RNA stand as a cap 2. Segments of the RNA stand that do not actually code for protein are removed 3. Segments of the RNA that do code for the protein are reconnected 4. Extra adenine nucleotides are added to the end of the RNA strand, forming a tail 5. The completed messenger RNA (mRNA) leaves the nucleus
In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____.includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns
An anticodon is _____.a set of triplet bases that is complementary to a codon triplet on mRNA
BioFlix Activity: Protein Synthesis -- Translationa. mRNA b. Small subunit of ribosome c. Large subunit of ribosome d. Amino acid e. tRNA f. Anticodon
If protein production were an assembly line, a ribosome would be _____.the worker who puts all of the pieces together
At the start of translation, where does the initiator tRNA bind?start codon on the mRNA molecule
Which of these is a tRNA?B
The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____.CUG
What is the name of the process shown in the diagram?initiation (of translation)
The initiator tRNA attaches at the ribosome's _____ site.P
The translation process in eukaryotes requires all of the following: _____.transfer RNA, ribosomes, AUG codons
In eukaryotes, the process of transcription is controlled by _____.DNA
How do mutations affect an organism?all of the above
DNA replication occurs at an unbelievably fast rate. Once replication is complete, we can expect to find a _____ number of mistakes.small
A female that is planning to become pregnant is concerned about her exposure to environmental mutagens which may have caused DNA mutations. In order for these mutations to become heritable, they must affect the:her egg cells
Which of the following would indicate a base pairing mutation in DNA?a G paired with a T
The type of mutation represented below is a(n) _____. The big red fly had one eye (wild type) The fbi gre dfl yha don eey (mutant)shift in reading frame
after dna
studybud

Your Answer

Surround your text in *italics* or **bold**, to write a math equation use, for example, $x^2+2x+1=0$ or $$\beta^2-1=0$$

Use LaTeX to type formulas and markdown to format text. See example.

Sign up or Log in

  • Answer the question above my logging into the following networks
Sign in
Sign in
Sign in

Post as a guest

  • Your email will not be shared or posted anywhere on our site
  •  

Stats
Views: 73
Asked: 2 years ago

Related